BLAST - Install locally

You can download the BLAST software for Windows or Linux and install it on your computer. The software is provided by NCBI under this link:

http://www.ncbi.nlm.nih.gov/BLAST/download.shtml

Make sure you download the ‘blast’ package, not the ‘netblast’ or ‘wwwblast’ package. This will retrieve an executable which contains the compressed BLAST software package. For Windows, the executable has a name similar to

blast-2.2.17-ia32-win32.exe

Save this file to a directory where you want to install BLAST. Then double click on it in the explorer – this will uncompress all contained files into the same directory where you have stored the file. The directory structure should look like this:

Directory structure created by BLAST installation

The bin directory contains the executables that you will need to perform actual BLAST searches. Make sure that you are in that directory when you execute BLAST or that your system path contains the BLAST bin directory.

BLAST is a command-line program. Therefore, in order to use it, you will need to go to the command line. Under Windows, you can do that by clicking on ‘Start’, then ‘Run…’, then enter ‘cmd’ and press ‘Ok’.

To perform your first sequence search, enter this command line:

blastall -pblastn -d..\data\UniVec

‘-pblastn’ means that we will use the blastn program out of the BLAST family of sequence-specific programs. ‘-d..\data\UniVec’ specifies the database to use. See the BLAST parameters article for more information.

This will start BLAST which in turn will wait for your input. Enter this sequence:

atcgctgacgagctattacgtagctgcgcgtcagtcgatgcgcgctagc

You need to tell BLAST that the input is finished. Press CTRL+Z twice to do that. BLAST will then run a homology search of the entered sequence against the UniVec database (a database of common vector and oligo sequences that can be used for the detection of DNA cross contamination; UniVec comes with the BLAST installation).

The result will look similar to this one:

BLASTN 2.2.18 [Mar-02-2008]

Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
“Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs”, Nucleic Acids Res. 25:3389-3402.

Query=
(49 letters)

Database: UniVec (build 4.0)
2416 sequences; 597,480 total letters

Searching…………………………………………..done

Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|uv|U59231.1:5112-7487 Cloning vector cLHYGpk                       24   1.0
gnl|uv|NGB00020.1:2420-2635 New England BioLabs cloning vector p…    24   1.0
gnl|uv|NGB00021.1:2421-2633 New England BioLabs cloning vector p…    24   1.0
gnl|uv|NGB00023.1:2420-2630 New England BioLabs cloning vector p…    24   1.0
gnl|uv|NGB00022.1:2398-2663 New England BioLabs cloning vector p…    24   1.0
gnl|uv|U89960.1:1471-2257 Cloning vector pEG202 (pLexA)                24   1.0
gnl|uv|AF234290.1:269-4296 Binary vector pCAMBIA-0380                  22   4.1
gnl|uv|U16857.1:2678-3227 Fusion cloning vector pTRXFUS                22   4.1
gnl|uv|U09365.1:9777-10659 Binary vector Bin19                         22   4.1

>gnl|uv|U59231.1:5112-7487 Cloning vector cLHYGpk
Length = 2376

Score = 24.3 bits (12), Expect = 1.0
Identities = 12/12 (100%)
Strand = Plus / Plus

Query: 34   gtcgatgcgcgc 45
||||||||||||
Sbjct: 1499 gtcgatgcgcgc 1510

>gnl|uv|NGB00020.1:2420-2635 New England BioLabs cloning vector
pLITMUS28
Length = 216

Score = 24.3 bits (12), Expect = 1.0
Identities = 12/12 (100%)
Strand = Plus / Minus

Query: 14 tattacgtagct 25
||||||||||||
Sbjct: 34 tattacgtagct 23

>gnl|uv|NGB00021.1:2421-2633 New England BioLabs cloning vector
pLITMUS29
Length = 213

Score = 24.3 bits (12), Expect = 1.0
Identities = 12/12 (100%)
Strand = Plus / Minus

Query: 14 tattacgtagct 25
||||||||||||
Sbjct: 33 tattacgtagct 22

>gnl|uv|NGB00023.1:2420-2630 New England BioLabs cloning vector
pLITMUS39
Length = 211

Score = 24.3 bits (12), Expect = 1.0
Identities = 12/12 (100%)
Strand = Plus / Minus

Query: 14 tattacgtagct 25
||||||||||||
Sbjct: 34 tattacgtagct 23

>gnl|uv|NGB00022.1:2398-2663 New England BioLabs cloning vector
pLITMUS38
Length = 266

Score = 24.3 bits (12), Expect = 1.0
Identities = 12/12 (100%)
Strand = Plus / Minus

Query: 14 tattacgtagct 25
||||||||||||
Sbjct: 56 tattacgtagct 45

>gnl|uv|U89960.1:1471-2257 Cloning vector pEG202 (pLexA)
Length = 787

Score = 24.3 bits (12), Expect = 1.0
Identities = 12/12 (100%)
Strand = Plus / Plus

Query: 23 gctgcgcgtcag 34
||||||||||||
Sbjct: 403 gctgcgcgtcag 414

>gnl|uv|AF234290.1:269-4296 Binary vector pCAMBIA-0380
Length = 4028

Score = 22.3 bits (11), Expect = 4.1
Identities = 11/11 (100%)
Strand = Plus / Minus

Query: 20   gtagctgcgcg 30
|||||||||||
Sbjct: 2245 gtagctgcgcg 2235

>gnl|uv|U16857.1:2678-3227 Fusion cloning vector pTRXFUS
Length = 550

Score = 22.3 bits (11), Expect = 4.1
Identities = 11/11 (100%)
Strand = Plus / Plus

Query: 1   atcgctgacga 11
|||||||||||
Sbjct: 182 atcgctgacga 192

>gnl|uv|U09365.1:9777-10659 Binary vector Bin19
Length = 883

Score = 22.3 bits (11), Expect = 4.1
Identities = 11/11 (100%)
Strand = Plus / Minus

Query: 22 agctgcgcgtc 32
|||||||||||
Sbjct: 362 agctgcgcgtc 352

As you can see, BLAST prints a list of matches against the database, including a convenient alignment of matching subsequences. See the BLAST output article for more information.

Now that you have performed your first local BLAST search, you may want to read up on how to create BLAST databases from existing sequence files, or how to download readymade databases.